forward reverse primer set Search Results


86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Qiagen forward and reverse primers
Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Qiagen
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biomics Biotechnologies forward and reverse primers
Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent forward and reverse primers
Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GeneWorks forward and reverse primers
Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/GeneWorks
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eurofins Genomics primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc
Primer: Thrap3 I2 Reverse: Caagcagaagacggcatacgagatacatcg Attggcctggttcggtcttctc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc/product/Eurofins Genomics
Average 90 stars, based on 1 article reviews
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pacific Biosciences the primer pair encodes forward and reverse barcodes for amplicon sequencing
The Primer Pair Encodes Forward And Reverse Barcodes For Amplicon Sequencing, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the primer pair encodes forward and reverse barcodes for amplicon sequencing/product/Pacific Biosciences
Average 90 stars, based on 1 article reviews
the primer pair encodes forward and reverse barcodes for amplicon sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Metabion International AG mouse primers
Mouse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse primers/product/Metabion International AG
Average 90 stars, based on 1 article reviews
mouse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biolegio bv barcoded forward primer and reverse primer mix biolegio bv
Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcoded forward primer and reverse primer mix biolegio bv/product/Biolegio bv
Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Metabion International AG forward reverse primers human vegf, vegfr1, vegfr2 β-actin
Forward Reverse Primers Human Vegf, Vegfr1, Vegfr2 β Actin, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward reverse primers human vegf, vegfr1, vegfr2 β-actin/product/Metabion International AG
Average 90 stars, based on 1 article reviews
forward reverse primers human vegf, vegfr1, vegfr2 β-actin - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Microsynth ag labelled forward primers
Labelled Forward Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/labelled forward primers/product/Microsynth ag
Average 90 stars, based on 1 article reviews
labelled forward primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Qiagen mirna-specific assays microrna-specific locked nucleic acid (lna)-enhanced forward reverse primers
Quantification of the levels of selected <t>serum</t> <t>miRNAs</t> using TaqMan <t>miRNA</t> assays in (A) male and (B) female F344 rats (n = 10-12/dose group). Data were normalized to miR-342-3p and are presented as mean fold change ± standard error between MEL&CYA-treated and control groups. Statistically significant differences are indicated by *, p <0.05, **, p <0.01, ***, p <0.001 (Dunnett's test).
Mirna Specific Assays Microrna Specific Locked Nucleic Acid (Lna) Enhanced Forward Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mirna-specific assays microrna-specific locked nucleic acid (lna)-enhanced forward reverse primers/product/Qiagen
Average 90 stars, based on 1 article reviews
mirna-specific assays microrna-specific locked nucleic acid (lna)-enhanced forward reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Quantification of the levels of selected serum miRNAs using TaqMan miRNA assays in (A) male and (B) female F344 rats (n = 10-12/dose group). Data were normalized to miR-342-3p and are presented as mean fold change ± standard error between MEL&CYA-treated and control groups. Statistically significant differences are indicated by *, p <0.05, **, p <0.01, ***, p <0.001 (Dunnett's test).

Journal: Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association

Article Title: Effects of a 28-day dietary co-exposure to melamine and cyanuric acid on the levels of serum microRNAs in male and female Fisher 344 rats

doi: 10.1016/j.fct.2016.09.013

Figure Lengend Snippet: Quantification of the levels of selected serum miRNAs using TaqMan miRNA assays in (A) male and (B) female F344 rats (n = 10-12/dose group). Data were normalized to miR-342-3p and are presented as mean fold change ± standard error between MEL&CYA-treated and control groups. Statistically significant differences are indicated by *, p <0.05, **, p <0.01, ***, p <0.001 (Dunnett's test).

Article Snippet: Quantification of serum miRNAs using Exiqon miRNA-specific assays MicroRNA-specific and Locked Nucleic Acid (LNA)-enhanced forward and reverse primers (Exiqon, ) were used to quantify the levels of selected serum miRNAs (n = 10-12/sex/dose group).

Techniques: